299 Table 1 | Bacterial probes used in the fluorescent in-situ hybridization (FISH). Statistics Characteristics of the study population were shown as proportions (%, n), means ± standard deviations (SD) or medians with interquartile range (IQR), as appropriate. Normality testing was performed using Kolmogorov-Smirnov tests. Distributions of urinary 52Cr-EDTA/Cr excretion were presented as median ± interquartile ranges (IQR) and presented in boxplots (10th-90th percentiles) grouped by inflammatory disease activity, as determined by the fecal calprotectin level (using 100 μg/g feces as cut-off value). Differences between groups were tested using the independent sample t-test or Mann-Whitney U-test, as appropriate. Partial correlations between urinary 52CrEDTA/creatinine ratio and other parameters were performed using the nonparametric Spearman’s correlation coefficient (ρ). Associations between correlated parameters were visualized in scatter plots with smoothed curves. Smoothing was empirically applied by nonlinear regression using 2nd order polynomial functions with 1/y2 weighting. Statistical analyses were performed using SPSS Statistics 23.0 for Windows. P-values ≤ 0.05 were considered as statistically significant. 52Cr-EDTA intestinal permeability in Crohn’s disease Table 1. Bacterial probes used in the fluorescent in-situ hybridization (FISH). Target Probe Label Sequence 3’ > 5’ Total bacteria Eub338 Rhodamine TGAGGATGCCCTCCGTCG F. prausnitzii Fprau645 FITC CAAAAAGAACTCATCACGTCTCC Enterobacteriaceae Ec1531 CY3 ACTACTGCTCCGTGATGCCAC
RkJQdWJsaXNoZXIy MjY0ODMw