584063-Bourgonje

178 Supplementary Tables Supplementary Table S1 | Nucleotide sequences of primers used for library construction for bacterial 16S rRNA gene (Illumina) sequencing. Bold uppercase letter highlight the index sequences (97 index sequences were used per sequence run, X indicates the subsequent index sequence), lower case letters indicate adapter sequences necessary for flow cell binding, underlined lowercase letters indicate binding sites for Illumina sequencing primers, and regular uppercase letters indicate the V3 and V4 region primers (341F for the forward primer, 806R for the reverse primer). The inclusion of four maximally degenerated bases (“NNNN”) maximizes the diversity during the first four bases of the run, which is important for unique cluster identification and base-calling accuracy. Chapter 5 Supplementary Table S1. Nucleotide sequences of primers used for library construction for bacterial 16S rRNA gene (Illumina) sequencing. Primer Sequence V3_F_modif ied aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatctNNNNCCTACGGGAG GCAGCAG V4_1R caagcagaagacggcatacgagatCGTGATgtgactggagttcagacgtgtgctcttccgatctGGACTAC HVGGGTWTCTAAT V4_2R caagcagaagacggcatacgagatACATCGgtgactggagttcagacgtgtgctcttccgatctGGACTAC HVGGGTWTCTAAT V4_3R caagcagaagacggcatacgagatGCCTAAgtgactggagttcagacgtgtgctcttccgatctGGACTAC HVGGGTWTCTAAT V4_XR caagcagaagacggcatacgagatXXXXXXgtgactggagttcagacgtgtgctcttccgatctGGACTAC HVGGGTWTCTAAT Bold uppercase letters highlight the index sequences (97 index sequences were used per sequence run, X indicates the subsequent index sequence), lower case letters indicate adapter sequences necessary for flow cell binding, underlined lowercase letters indicate binding sites for Illumina sequencing primers, and regular uppercase letters indicate the V3 and V4 region primers (341F for the forward primer, 806R for the reverse primer). The inclusion of four maximally degenerated bases (“NNNN”) maximizes the diversity during the first four bases of the run, which is importan for unique luster ident fication and base-calling accuracy.

RkJQdWJsaXNoZXIy MjY0ODMw